ID: 1058058651_1058058655

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1058058651 1058058655
Species Human (GRCh38) Human (GRCh38)
Location 9:100473593-100473615 9:100473630-100473652
Sequence CCGCTCGCCTTCTGCTGCTACAC TCTTCGCCTTCTCTCTGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149} {0: 1, 1: 0, 2: 4, 3: 30, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!