ID: 1058078398_1058078404

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1058078398 1058078404
Species Human (GRCh38) Human (GRCh38)
Location 9:100674205-100674227 9:100674228-100674250
Sequence CCTAATGTATATGTGCTGAGGGG TGAAAACAGATGGAAAGGGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 58, 4: 619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!