ID: 1058109568_1058109577 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1058109568 | 1058109577 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 9:101017677-101017699 | 9:101017717-101017739 |
| Sequence | CCGGCACCTGGTGAGAATTTTCT | GTGAAGGCAGAAGGGCAAAAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 2, 2: 30, 3: 141, 4: 757} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||