ID: 1058175994_1058176009

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1058175994 1058176009
Species Human (GRCh38) Human (GRCh38)
Location 9:101737622-101737644 9:101737655-101737677
Sequence CCGCCCTGGCGCCCTCCCCGGGC CCGGCGGCCCCCGGCCATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 624} {0: 1, 1: 0, 2: 1, 3: 16, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!