ID: 1058176040_1058176051

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1058176040 1058176051
Species Human (GRCh38) Human (GRCh38)
Location 9:101737746-101737768 9:101737779-101737801
Sequence CCTCTGGGCTCCTGCTCGGCTGT GCGGCTGGCCGCGCGGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 246} {0: 1, 1: 6, 2: 20, 3: 91, 4: 604}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!