ID: 1058196126_1058196128

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1058196126 1058196128
Species Human (GRCh38) Human (GRCh38)
Location 9:101978659-101978681 9:101978673-101978695
Sequence CCACCTGGATATCTCAATATAAT CAATATAATCTCCCTGTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 29, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!