ID: 1058240753_1058240755

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1058240753 1058240755
Species Human (GRCh38) Human (GRCh38)
Location 9:102555176-102555198 9:102555205-102555227
Sequence CCAAGCTGAGAACAAAATCAAGA CTCCATTTACAGTAGGCACAAGG
Strand - +
Off-target summary {0: 5, 1: 64, 2: 911, 3: 1390, 4: 1634} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!