ID: 1058271828_1058271832

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1058271828 1058271832
Species Human (GRCh38) Human (GRCh38)
Location 9:102982022-102982044 9:102982040-102982062
Sequence CCACCAAGTGAGGACCCAGTAAT GTAATTAGTCATCATTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 674} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!