ID: 1058421053_1058421058

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1058421053 1058421058
Species Human (GRCh38) Human (GRCh38)
Location 9:104833825-104833847 9:104833870-104833892
Sequence CCTCACATGGGTCAACACGAAAG CTCAATCAGCAGATCCAGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 20, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!