ID: 1058502379_1058502380

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1058502379 1058502380
Species Human (GRCh38) Human (GRCh38)
Location 9:105634039-105634061 9:105634074-105634096
Sequence CCTGCTAGTTTTAGCTTTCTTTT ATTTAGTTTACTTGATCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 199, 4: 2372} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!