ID: 1058504589_1058504593

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1058504589 1058504593
Species Human (GRCh38) Human (GRCh38)
Location 9:105655337-105655359 9:105655350-105655372
Sequence CCCAGGAAACAGTCAGTGAAAAG CAGTGAAAAGGCTCTGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 19, 3: 180, 4: 868}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!