ID: 1058520205_1058520212

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1058520205 1058520212
Species Human (GRCh38) Human (GRCh38)
Location 9:105808881-105808903 9:105808915-105808937
Sequence CCCATATCGCAGGGTGTGTACAC ATTGTTTGTAATATCCAGGGGGG
Strand - +
Off-target summary No data {0: 21, 1: 118, 2: 407, 3: 940, 4: 1517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!