ID: 1058572601_1058572603

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1058572601 1058572603
Species Human (GRCh38) Human (GRCh38)
Location 9:106363769-106363791 9:106363788-106363810
Sequence CCTTCATAGAGGAGAAATGCTGT CTGTGTTCTCACATGGAACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 72, 3: 616, 4: 1874}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!