ID: 1058618869_1058618878

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1058618869 1058618878
Species Human (GRCh38) Human (GRCh38)
Location 9:106862981-106863003 9:106863027-106863049
Sequence CCCTGGTTGCTCATTATTCAGAG GAGAGAGCGCGCGAGGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 118} {0: 1, 1: 1, 2: 8, 3: 403, 4: 5440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!