ID: 1058719885_1058719887

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1058719885 1058719887
Species Human (GRCh38) Human (GRCh38)
Location 9:107754219-107754241 9:107754240-107754262
Sequence CCTTTTGCTTGGCACTTCTCCTT TTGCTGCCACCATGTGAAGAAGG
Strand - +
Off-target summary {0: 148, 1: 333, 2: 641, 3: 677, 4: 1394} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!