ID: 1058773308_1058773318

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1058773308 1058773318
Species Human (GRCh38) Human (GRCh38)
Location 9:108260048-108260070 9:108260080-108260102
Sequence CCAAGGCCTCTTGGCCAGCTCCC CCATCACAGACACACTGGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!