ID: 1058819560_1058819565 |
View in Genome Browser |
Spacer: 23 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1058819560 | 1058819565 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 9:108717013-108717035 | 9:108717059-108717081 |
| Sequence | CCATCAGAGGTACACGGAGGAGA | TTCCAAACAATAGAAAAAGAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 815, 1: 8114, 2: 3455, 3: 2888, 4: 3102} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||