ID: 1058835405_1058835411

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1058835405 1058835411
Species Human (GRCh38) Human (GRCh38)
Location 9:108855331-108855353 9:108855346-108855368
Sequence CCCGCTCTCCACCACCAGCCCCG CAGCCCCGAGGTCTTGCCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 725} {0: 1, 1: 0, 2: 3, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!