ID: 1058897296_1058897300

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1058897296 1058897300
Species Human (GRCh38) Human (GRCh38)
Location 9:109411409-109411431 9:109411433-109411455
Sequence CCCCTCAGAGTCACAGGGATTAA CATCCCTGCTGTCACTGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 75, 4: 1840} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!