ID: 1058920314_1058920323

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1058920314 1058920323
Species Human (GRCh38) Human (GRCh38)
Location 9:109608264-109608286 9:109608310-109608332
Sequence CCTTCCTTCCTTCCCTCCTCCCT TTTGTCATATGCCAACTATGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!