ID: 1058961416_1058961424

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1058961416 1058961424
Species Human (GRCh38) Human (GRCh38)
Location 9:109995865-109995887 9:109995900-109995922
Sequence CCTTGGAGGCCTGAACTGGTGCA ATGGAGAGGAAGGATGAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 93, 4: 1034}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!