ID: 1058970125_1058970134

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1058970125 1058970134
Species Human (GRCh38) Human (GRCh38)
Location 9:110073722-110073744 9:110073749-110073771
Sequence CCCTCCCCAGAGTCTTTTCTCTG AGTTCTGAAAAATTGTTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 509} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!