ID: 1058985768_1058985780

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1058985768 1058985780
Species Human (GRCh38) Human (GRCh38)
Location 9:110207507-110207529 9:110207540-110207562
Sequence CCTCAGCCATTAAGTGAGACCTA AGTGGGGCAGGGCTGGGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149} {0: 1, 1: 1, 2: 7, 3: 92, 4: 906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!