ID: 1058987907_1058987911

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1058987907 1058987911
Species Human (GRCh38) Human (GRCh38)
Location 9:110225797-110225819 9:110225822-110225844
Sequence CCCTCCTCACTCTCCTTCTCTCT TTCCTGCCACCATGTAAAGAAGG
Strand - +
Off-target summary No data {0: 12, 1: 239, 2: 1223, 3: 2014, 4: 2623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!