ID: 1059037184_1059037190

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1059037184 1059037190
Species Human (GRCh38) Human (GRCh38)
Location 9:110767250-110767272 9:110767284-110767306
Sequence CCTCCCTACATCACTTTCTTTTT TTCTAGGAAGATGTGTGAGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!