ID: 1059044960_1059044965

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1059044960 1059044965
Species Human (GRCh38) Human (GRCh38)
Location 9:110856363-110856385 9:110856390-110856412
Sequence CCTGACTGTTACTCCTTCACAGG CTATGTCCTATAGAGTAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!