ID: 1059113267_1059113269

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1059113267 1059113269
Species Human (GRCh38) Human (GRCh38)
Location 9:111577273-111577295 9:111577318-111577340
Sequence CCTACTAGGATGGTTATAATAAA TGGTGAGTATGTAGAGAAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 87, 3: 1340, 4: 21945}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!