ID: 1059184169_1059184171

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1059184169 1059184171
Species Human (GRCh38) Human (GRCh38)
Location 9:112251163-112251185 9:112251177-112251199
Sequence CCTCTACTTTGACAAAGAGTGGC AAGAGTGGCAATCAGGTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78} {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!