ID: 1059209045_1059209050

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1059209045 1059209050
Species Human (GRCh38) Human (GRCh38)
Location 9:112494565-112494587 9:112494581-112494603
Sequence CCTCAGGTGATCCTCCCAGTTTA CAGTTTAGCCCCAAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 124, 3: 2672, 4: 25062} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!