ID: 1059218080_1059218087

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1059218080 1059218087
Species Human (GRCh38) Human (GRCh38)
Location 9:112585485-112585507 9:112585516-112585538
Sequence CCTGTGAAAGGCTGTGCATGTGA TGTCCTCCACGGGGCTCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 176} {0: 1, 1: 0, 2: 3, 3: 12, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!