ID: 1059277050_1059277062

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1059277050 1059277062
Species Human (GRCh38) Human (GRCh38)
Location 9:113106319-113106341 9:113106369-113106391
Sequence CCACAGAGGTGACACTGTGTGCA CTTTGTTTCCTGTGCCCCCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 6, 3: 26, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!