ID: 1059284018_1059284024

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1059284018 1059284024
Species Human (GRCh38) Human (GRCh38)
Location 9:113157458-113157480 9:113157490-113157512
Sequence CCGAGCCAGTTGGTCCAGTGAGG CCCACACCTCTATTCTCATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!