ID: 1059294903_1059294904

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1059294903 1059294904
Species Human (GRCh38) Human (GRCh38)
Location 9:113261637-113261659 9:113261666-113261688
Sequence CCTCTAAAACTGTGATTTTCAAG CGTGCATCAGAATCACCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 410} {0: 1, 1: 9, 2: 166, 3: 517, 4: 1008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!