ID: 1059297841_1059297843

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1059297841 1059297843
Species Human (GRCh38) Human (GRCh38)
Location 9:113288182-113288204 9:113288201-113288223
Sequence CCAGTGGCAGATATTGAAGGCCA GCCATACAGTGCGTGTGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112} {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!