ID: 1059303905_1059303913

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1059303905 1059303913
Species Human (GRCh38) Human (GRCh38)
Location 9:113339256-113339278 9:113339302-113339324
Sequence CCTATCCGACTGTTCTATTCCAT TGTGACTTGCTGAAGGTCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 63, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!