ID: 1059306917_1059306925

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1059306917 1059306925
Species Human (GRCh38) Human (GRCh38)
Location 9:113360957-113360979 9:113361002-113361024
Sequence CCCTGCTAAGTCAGTGTAGCCAG ATCATCCTTGATATCTGATCAGG
Strand - +
Off-target summary No data {0: 6, 1: 14, 2: 43, 3: 65, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!