ID: 1059309766_1059309771

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1059309766 1059309771
Species Human (GRCh38) Human (GRCh38)
Location 9:113380235-113380257 9:113380250-113380272
Sequence CCTGAAATCCTAGCACTTTGGAA CTTTGGAAGGCTAAGGTGGAAGG
Strand - +
Off-target summary No data {0: 3, 1: 234, 2: 5941, 3: 59931, 4: 139238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!