ID: 1059314127_1059314138

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1059314127 1059314138
Species Human (GRCh38) Human (GRCh38)
Location 9:113410028-113410050 9:113410071-113410093
Sequence CCTCCCTTATGCCTCTGTCCCGC GCACGAAGACGCTGGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 175} {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!