ID: 1059367774_1059367781

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1059367774 1059367781
Species Human (GRCh38) Human (GRCh38)
Location 9:113800152-113800174 9:113800177-113800199
Sequence CCTGCCACTTCTAAGACCCTATC CAGAAAACAGCAGCTGTGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!