ID: 1059389278_1059389284

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1059389278 1059389284
Species Human (GRCh38) Human (GRCh38)
Location 9:113988662-113988684 9:113988676-113988698
Sequence CCTCTGCCCCCTTCCTGGCTGAG CTGGCTGAGAGAACCTTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 72, 4: 633} {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!