ID: 1059423948_1059423954

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1059423948 1059423954
Species Human (GRCh38) Human (GRCh38)
Location 9:114209356-114209378 9:114209373-114209395
Sequence CCCAGCCGCGAGCTTCCTTCTGC TTCTGCAGGTCCTGGAGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 21, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!