ID: 1059460417_1059460427

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1059460417 1059460427
Species Human (GRCh38) Human (GRCh38)
Location 9:114426077-114426099 9:114426110-114426132
Sequence CCAATGGAGGGCCCTGGTGTGGG TGAGAGGAGAGCCAGGGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 686} {0: 1, 1: 0, 2: 3, 3: 49, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!