ID: 1059460417_1059460428

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1059460417 1059460428
Species Human (GRCh38) Human (GRCh38)
Location 9:114426077-114426099 9:114426113-114426135
Sequence CCAATGGAGGGCCCTGGTGTGGG GAGGAGAGCCAGGGCGGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 686} {0: 1, 1: 0, 2: 5, 3: 58, 4: 714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!