ID: 1059467533_1059467539

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1059467533 1059467539
Species Human (GRCh38) Human (GRCh38)
Location 9:114478552-114478574 9:114478565-114478587
Sequence CCTTTTTCTCATCCCCTCCTTGC CCCTCCTTGCAGGAGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 779} {0: 1, 1: 0, 2: 3, 3: 25, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!