ID: 1059535147_1059535154

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1059535147 1059535154
Species Human (GRCh38) Human (GRCh38)
Location 9:115073738-115073760 9:115073773-115073795
Sequence CCCACTGGCCTGTGGGGAGACTG TAGCGGTCAAATTTGGCCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228} {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!