ID: 1059602845_1059602853

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1059602845 1059602853
Species Human (GRCh38) Human (GRCh38)
Location 9:115800160-115800182 9:115800189-115800211
Sequence CCTACTTTTAGAGTGCCTAGAAC AGATGGAAAGGGTGAATAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 60, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!