ID: 1059615312_1059615315

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1059615312 1059615315
Species Human (GRCh38) Human (GRCh38)
Location 9:115944464-115944486 9:115944488-115944510
Sequence CCAGTGTCCAGCTGCTGATACTT TCTTGAAATTTCTAAGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!