ID: 1059650687_1059650698

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1059650687 1059650698
Species Human (GRCh38) Human (GRCh38)
Location 9:116313294-116313316 9:116313326-116313348
Sequence CCCACCCCAGAATCCTTTTCCAA ATATGTGCAGGTGGTGAAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!