ID: 1059792947_1059792954

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1059792947 1059792954
Species Human (GRCh38) Human (GRCh38)
Location 9:117660410-117660432 9:117660457-117660479
Sequence CCATGCTGCCTCTGTGGAGGCAG AGGGCCGGAAGATTCACCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 58, 4: 396} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!