ID: 1059819029_1059819033

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1059819029 1059819033
Species Human (GRCh38) Human (GRCh38)
Location 9:117951242-117951264 9:117951279-117951301
Sequence CCCACCCGCTCTGCTAAAGCACA AAAAGCCATTTTCTATCCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 31, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!